9700/12 Biology Oct Nov 2016 Online Test | Cambridge AS and A Level MCQ
Sickle cell anaemia is caused by a mutation in an allele of the gene that codes for the $\beta $-globin polypeptide of haemoglobin.
The diagram shows the sequence of bases in a small section of the coding strand of DNA for
both the $H{b^A}$ (normal) and $H{b^S}$ (sickle cell) $\beta $-globin alleles.
$H{b^A}{\text{ }}CTGACTCCTGAGGAGAAGTCT$
$H{b^S}{\text{ }}CTGACTCCTGTGGAGAAGTCT$
How will the mutation in the allele…