گاما رو نصب کن!

{{ number }}
اعلان ها
اعلان جدیدی وجود ندارد!
کاربر جدید

جستجو

پربازدیدها: #{{ tag.title }}

جستجوهای پرتکرار

میتونی لایو بذاری!
Biology (9700) 1403/11/29

9700/11 Biology May Jun 2018 Online Test | Cambridge AS and A Level MCQ

Cambridge AS & A Level Biology (9700) شهریور 2018 مشاهده نمونه سوال
شامل مباحث: AS Level
  تعداد سوالات: 40
  سطح دشواری: متوسط
  شروع: آزاد
  پایان: آزاد
  مدت پاسخگویی: 60 دقیقه

9700/11 Biology May Jun 2018 Online Test | Cambridge AS and A Level MCQ
پیش نمایش صفحه اول فایل
نوع: Paper 1
بروزرسانی شده در 29 بهمن 1403
  

Sickle cell anaemia is caused by a mutation in an allele of the gene that codes for the $\beta $-globin polypeptide of haemoglobin.

The diagram shows the sequence of bases in a small section of the coding strand of DNA for both the HbA (normal) and HbS (sickle cell) $\beta $-globin alleles.

HbA CTGACTCCTGAGGAGAAGTCT

HbS CTGACTCCTGTGGAGAAGTCT

How will the mutation in the HbS allele result in the production of an altered…