گاما رو نصب کن!

{{ number }}
اعلان ها
اعلان جدیدی وجود ندارد!
کاربر جدید

جستجو

پربازدیدها: #{{ tag.title }}

جستجوهای پرتکرار

میتونی لایو بذاری!

Sickle cell anaemia is caused by a mutation in an allele of the gene that codes for the $\beta $-globin polypeptide of haemoglobin.

The diagram shows the sequence of bases in a small section of the coding strand of DNA for both the HbA (normal) and HbS (sickle cell) $\beta $-globin alleles.

HbA CTGACTCCTGAGGAGAAGTCT

HbS CTGACTCCTGTGGAGAAGTCT

How will the mutation in the HbS allele result in the production of an altered version of the $\beta $-globin polypeptide? 

1 ) 

A tRNA molecule with the anticodon GUG will hydrogen bond to the altered codon on mRNA. 

2 ) 

All the amino acids coded for after the mutation will differ from those in the HbA protein.

3 ) 

mRNA transcribed from the HbS allele will contain the codon CAC instead of the codon CTC. 

4 ) 

The ribosome will be unable to continue translation of the HbS mRNA after the altered codon.  

تحلیل ویدئویی تست

منتظریم اولین نفر تحلیلش کنه!